|
Wageningen University and Research
antioxidative strain of l. fermentum  167 )." width="250" height="auto" />Antioxidative Strain Of L. Fermentum, supplied by Wageningen University and Research, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/antioxidative+strain+of+l++fermentum/pmc02670518-225-19-38 Average 90 stars, based on 1 article reviews
antioxidative strain of l. fermentum - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Metagenics Inc
l. fermentum 167 )." width="250" height="auto" />L. Fermentum, supplied by Metagenics Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/l++fermentum/us08642051-299-29-4 Average 90 stars, based on 1 article reviews
l. fermentum - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
NCIMB Ltd
lactobacillus fermentum ncimb 5221 167 )." width="250" height="auto" />Lactobacillus Fermentum Ncimb 5221, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/l++fermentum+ncimb+5221/10__18433_slash_j3kp4n-17-113-115 Average 90 stars, based on 1 article reviews
lactobacillus fermentum ncimb 5221 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Wageningen University and Research
l. fermentum 167 )." width="250" height="auto" />L. Fermentum, supplied by Wageningen University and Research, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/l++fermentum/pmc06587490-77-38-48 Average 90 stars, based on 1 article reviews
l. fermentum - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
NCIMB Ltd
csfs produced by l. fermentum ncimb 5221 167 )." width="250" height="auto" />Csfs Produced By L. Fermentum Ncimb 5221, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/csfs+produced+by+l++fermentum+ncimb+5221/10__1590_slash_s2175___97902022e19400-161-6-11 Average 90 stars, based on 1 article reviews
csfs produced by l. fermentum ncimb 5221 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
China Center for Type Culture Collection
l. fermentum cctcc ab2010204  L. Fermentum Cctcc Ab2010204, supplied by China Center for Type Culture Collection, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/l++fermentum+9+4/pmc05454770-8-6-8 Average 90 stars, based on 1 article reviews
l. fermentum cctcc ab2010204 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
NCIMB Ltd
l. fermentum 2797 L. Fermentum 2797, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/l++fermentum+5221/10__4172_slash_2161___1122__1000141-101-28-30 Average 90 stars, based on 1 article reviews
l. fermentum 2797 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
NCIMB Ltd
gos produced from l. fermentum ncimb 30226 Gos Produced From L. Fermentum Ncimb 30226, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/gos+produced+from+l++fermentum+ncimb+30226/us09913857-205-19-29 Average 90 stars, based on 1 article reviews
gos produced from l. fermentum ncimb 30226 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Pharmax Limited
l fermentum (cul-67) L Fermentum (Cul 67), supplied by Pharmax Limited, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/l+fermentum++cul+67+/pmc06419786-54-31-61 Average 90 stars, based on 1 article reviews
l fermentum (cul-67) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Genmont Inc
l. fermentum -2 L. Fermentum 2, supplied by Genmont Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/l++fermentum++2/pmc07847631-29-28-40 Average 90 stars, based on 1 article reviews
l. fermentum -2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
NCIMB Ltd
ssfs and sff+la formulations corresponding to l. fermentum ncimb 5221 Ssfs And Sff+La Formulations Corresponding To L. Fermentum Ncimb 5221, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/ssfs+and+sff+la+formulations+corresponding+to+l++fermentum+ncimb+5221/10__4172_slash_1948___5956__1000354-202-59-47 Average 90 stars, based on 1 article reviews
ssfs and sff+la formulations corresponding to l. fermentum ncimb 5221 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
NCIMB Ltd
alginate-polylysine-alginate (apa) microcapsules containing strains such as l. fermentum ncimb 5221 Alginate Polylysine Alginate (Apa) Microcapsules Containing Strains Such As L. Fermentum Ncimb 5221, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/l%2E+fermentum/alginate+polylysine+alginate++apa++microcapsules+containing+strains+such+as+l++fermentum+ncimb+5221/pmc11609427-449-10-15 Average 90 stars, based on 1 article reviews
alginate-polylysine-alginate (apa) microcapsules containing strains such as l. fermentum ncimb 5221 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
167 )." width="100%" height="100%">
Journal: Microbial Ecology in Health and Disease
Article Title: Lactobacillus fermentum ME-3 – an antimicrobial and antioxidative probiotic
doi: 10.1080/08910600902815561
Figure Lengend Snippet: Improvement of OxS-related indices of blood sera in the synbiotic DBRP crossover study in healthy volunteers (
Article Snippet: The European Research Council 5th FW offered the possibility of a joint volunteer study by the application of the
Techniques:
Journal: Frontiers in Microbiology
Article Title: Characterization of Feruloyl Esterases Produced by the Four Lactobacillus Species: L. amylovorus , L. acidophilus , L. farciminis and L. fermentum , Isolated from Ensiled Corn Stover
doi: 10.3389/fmicb.2017.00941
Figure Lengend Snippet: Oligonucleotide primers used in this study.
Article Snippet: P7 , ACTTTGCGCCCCGCCGCTTGT , , ,
Techniques: Sequencing, Plasmid Preparation
Journal: Frontiers in Microbiology
Article Title: Characterization of Feruloyl Esterases Produced by the Four Lactobacillus Species: L. amylovorus , L. acidophilus , L. farciminis and L. fermentum , Isolated from Ensiled Corn Stover
doi: 10.3389/fmicb.2017.00941
Figure Lengend Snippet: Plate screening assay showing FAE activities by clear zones around the individual colonies. The plates were incubated at 37°C for 72 h. 1 is an L. amylovorus CGMCC 11056 colony. 2 is an L. acidophilus CCTCC AB2010208 colony. 3 is an L. farciminis CCTCC AB2016237 colony. 4 is an L. fermentum CCTCC AB2010204 colony.
Article Snippet: P7 , ACTTTGCGCCCCGCCGCTTGT , , ,
Techniques: Screening Assay, Incubation